Transcription and Translation

Presentation on theme: "Transcription and Translation"— Presentation transcript:

1 Transcription and Translation
DNA/RNA Transcription and Translation

2 Review… DNA is responsible for controlling the production of proteins in the cell, which is essential to life DNARNAProteins Chromosomes contain several thousand genes, each with the directions to make one protein Do you remember the organelle where proteins are produced?

3 Where are Proteins Produced?
Ribosomes! Ribosomes are where proteins are made Ribosomes are found in two places: Free floating in the cytoplasm Attached to Endoplasmic Reticulum (Rough ER) So…how does information needed to build the protein get delivered from the DNA to the ribosomes??? -With the help of RNA in a process called protein synthesis!

4 What is RNA? RNA stands for ribonucleic acid
One subunit of RNA is a nucleotide (just like DNA!) 1 - 5 carbon sugar (it’s ribose in RNA) 1 - phosphate group 1 – nitrogenous (N) base Three types of RNA mRNA, rRNA, tRNA First, we will look at mRNA!

5 A Closer Look: mRNA Looking at the mRNA to the right, how is it different visually from DNA? It is single stranded It is shorter and able to leave the nucleus The sugar is ribose There is a different base Uracil (U) takes the place of Thymine (T)

6 About mRNA The job of mRNA is to take the directions for one gene and transport it to a ribosome in the cytoplasm where it is translated. This is so the cell can begin assembling amino acids, the building blocks of proteins Like it’s name, it is sending a message on how to do the job This is part of a process called protein synthesis A ribosome up close!!

7 Protein Synthesis Protein synthesis is a two stages process
Transcription and Translation In this process, a messenger molecule (mRNA) carries instructions from DNA to ribosomes DNA cannot leave the nucleus! mRNA can! mRNA makes it possible for proteins to be assembled by ribosomes outside of the nucleus

8 Protein Synthesis Transcription

9 Protein Synthesis: Transcription
Transcription happens when DNA is turned into mRNA This happens when proteins need to be made in the cytoplasm! Since DNA cannot leave the nucleus, it is transcribed into RNA (DNARNA) Transcribe: to copy (copy in the same nucleic acid language, but only copy what is needed)

10 Protein Synthesis: Transcription
How does it happen? After an enzyme targets the portion of the DNA that should be copied (initiation), the sections of DNA (genes) will temporarily unwind to allow mRNA to transcribe (copy). This will continue until an enzyme signals “the end” mRNA leaves the nucleus, travels into the cytoplasm and attaches to a ribosome The “message” from DNA can now be translated to make a protein

11 Transcription

12 Practicing Transcription
Transcribing DNA to mRNA is very easy if you remember these complementary pairs! C (in RNA) will attach to a G (in DNA) G (in RNA) will attach to a C (in DNA) A (in RNA) will attach to a T (in DNA) U (in RNA) will attach to a A (in DNA) Try it! A piece of DNA reads: T A G C A T T C C G A U transcribe to mRNA:___________________________

13 Practicing Transcription
If 1 side of DNA reads: A A G C G T A T C C C G Then mRNA reads: ____________________________

14 Bellringer-3/27/15 Describe the steps taken during transcription.
Transcribe the following to mRNA: AAT CGA TAG CCG ATA

15 Protein Synthesis Translation

16 TRANSLATION Translation: the process in which mRNA is used as a blueprint to form chains of amino acids (RNAProtein) Amino acids linked together form a protein Translate: To change a sentence from one language (nucleic acid) to another (amino acid) Every 3 letters on an mRNA chain = codon Each codon (3 DNA letters) = 1 amino acid

17 Reading a Codon Chart Given the mRNA, we can read a codon chart to translated into the amino acid it codes for Remember, 1 word in nucleic acid language is a codon (three nucleotides)

18 Practice: Reading a Codon Chart
What amino acid is coded for? A U G G U C G C C C G A U A A

19 Protein Synthesis: Translation
Occurs in a ribosome in ALL cells This process uses all three forms of RNA (mRNA, rRNA, and tRNA) DNA is not directly used! mRNA rRNA AA (amino acid) tRNA anticodon

20 Steps of Translation 1.The mRNA leaves the nucleus and lands on a ribosome (rRNA)

21 Steps of Translation 2. tRNA (with the correct anticodon) lands on the ribosome opposite a codon on the mRNA

22 tRNA: A Closer Look Notice the tRNA is carrying the amino acid leucine, coded for by the sequence “CUA” (check your codon chart”) The tRNA knows how to match using bases! In RNA, GC and AU: So…mRNA codon reads “CUA,” so the tRNA anticodon will be “GAU”

23 tRNA: A Closer Look Amino acid anticodon

24 Steps of Translation 3. The tRNA leaves the ribosome, but the amino acid that it coded for stays on the ribosome to wait for next codon to be read

25 Steps of Translation 4. The ribosome moves to the next codon bringing in another amino acid to the growing protein chain.

26 An Amino Acid Chain The amino acid chain will ALWAYS begin with the “START codon”- AUG The tRNA will continue to add amino acids until it reaches a “STOP codon” (UAA, UAG, UGA) When it reaches a stop codon, then a complete protein has been built! The protein unattaches from the ribosome.

27 DNA molecule DNA strand (template) 3¢ 5¢ TRANSCRIPTION mRNA 5¢ 3¢ Codon TRANSLATION Protein Amino acid

28 Let’s practice……. Given the strand of DNA below, what would it’s complementary DNA strand read? ATC Now, transcribe the DNA to mRNA What amino acid does the codon code for? (use codon chart) What would the anticodon on the tRNA read?

29 Try Again! Given the strand of DNA below, what would it’s complementary DNA strand read? TGA Now, transcribe the DNA to mRNA What amino acid does the codon code for? (use codon chart) What would the anticodon on the tRNA read?

30 Bellringer-3/30/15 Given the strand of DNA below, what would it’s complementary DNA strand read? ATC GCT AGG TAA Now, transcribe the DNA to mRNA What amino acid does the codon code for during translation? (use codon chart) What would the anticodon on the tRNA read?

31 Bellringer-3/31/15 Describe the steps to protein synthesis in detail. Be sure to address the information below in your explanation: Where does transcription occur? What is the purpose of mRNA? Where does translation occur? What does a tRNA molecule do? How does the process end?

32 Mutations Changes to DNA

33 Mutations Changes to DNA are called mutations change the DNA
changes the mRNA may change protein may change trait DNA TACGCACATTTACGTACG mRNA AUGCGUGUAAAUGCAUGC aa protein trait

34 Types of mutations Changes to the letters (A,C,T,G bases) in the DNA
point mutation change to ONE letter (base) in the DNA may (or may not) cause change to protein frameshift mutation addition of a new letter (base) in the DNA sequence deletion of a letter (base) in the DNA both of these shift the DNA so it changes how the codons are read big changes to protein!

35 Does this change the sentence?
Point Mutations One base change can change the meaning of the whole protein THEFATCATANDTHEREDRATRAN Does this change the sentence? A LITTLE! THEFATCARANDTHEREDRATRAN OR THEFATCATENDTHEREDRATRAN

36 Does this change the protein?
Point Mutations Missense mutation = changes amino acid AUGCGUGUAUACGCAUGCGAGUGA Met Arg Val Tyr Ala Cys Glu Stop Does this change the protein? DEPENDS… AUGCGUGUAUACGUAUGCGAGUGA Met Arg Val Tyr Val Cys Glu Stop

37 Misshapen sickle cells
Sickle cell anemia Hemoglobin protein in red blood cells strikes 1 out of 400 African Americans limits activity, painful & may die young Normal round cells Misshapen sickle cells Only 1 out of 146 amino acids

38 The code has repeats in it! Does this change the protein?
Point Mutations Silent mutation = no change to protein AUGCGUGUAUACGCAUGCGAGUGA Met Arg Val Tyr Ala Cys Glu Stop The code has repeats in it! Does this change the protein? Why not? AUGCGUGUAUACGCUUGCGAGUGA Met Arg Val Tyr Ala Cys Glu Stop

39 Really destroyed that protein!
Point Mutations Nonsense mutation = change to STOP AUGCGUGUAUACGCAUGCGAGUGA Met Arg Val Tyr Ala Cys Glu Stop Really destroyed that protein! AUGCGUGUAUAAGCAUGCGAGUGA Met Arg Val Stop

40 Does this change the sentence?
Frameshift Mutations Add or delete one or more bases changes the meaning of the whole protein THEFATCATANDTHEREDRATRAN Does this change the sentence? A LOT! Delete one! Add one! THEFATCANTANDTHEREDRATRAN OR THEFATCAANDTHEREDRATRAN

41 Does this change the protein?
Frameshift Mutations Addition = add one or more bases AUGCGUGUAUACGCAUGCGAGUGA Met Arg Val Tyr Ala Cys Glu Stop Does this change the protein? A LOT! AUGCGUGUAUACGUCAUGCGAGUGA Met Arg Val Tyr Val Met Arg Val

42 Does this change the protein?
Frameshift Mutations Deletion = lose one or more bases AUGCGUGUAUACGCAUGCGAGUGA Met Arg Val Tyr Ala Cys Glu Stop Does this change the protein? A LOT! AUGCGUGUAUACGAUGCGAGUGA Met Arg Val Tyr Asp Ala Ser

43 Bellringer-4/1/15 Name and describe the two main types of mutations we talked about yesterday. Do mutations always cause a change in amino acid? Why or why not?